Review



gene names  (Biotechnology Information)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Biotechnology Information gene names
    Gene Names, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene names/product/Biotechnology Information
    Average 86 stars, based on 1 article reviews
    gene names - by Bioz Stars, 2026-06
    86/100 stars

    Images



    Similar Products

    gene names  (ATCC)
    92
    ATCC gene names
    Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene names/product/ATCC
    Average 92 stars, based on 1 article reviews
    gene names - by Bioz Stars, 2026-06
    92/100 stars
    		  Buy from Supplier
    gene name endra  (Endra Life Sciences)
    86
    Endra Life Sciences gene name endra
    Gene Name Endra, supplied by Endra Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene name endra/product/Endra Life Sciences
    Average 86 stars, based on 1 article reviews
    gene name endra - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    antibody information gene name  (Cell Signaling Technology Inc)
    86
    Cell Signaling Technology Inc antibody information gene name
    Antibody Information Gene Name, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibody information gene name/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    antibody information gene name - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    gene names  (Biotechnology Information)
    86
    Biotechnology Information gene names
    Gene Names, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene names/product/Biotechnology Information
    Average 86 stars, based on 1 article reviews
    gene names - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    n instrument name  (Qiagen)
    94
    Qiagen n instrument name
    N Instrument Name, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n instrument name/product/Qiagen
    Average 94 stars, based on 1 article reviews
    n instrument name - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    gene named succinate dehydrogenase c sdhc  (Biotechnology Information)
    86
    Biotechnology Information gene named succinate dehydrogenase c sdhc
    Gene Named Succinate Dehydrogenase C Sdhc, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene named succinate dehydrogenase c sdhc/product/Biotechnology Information
    Average 86 stars, based on 1 article reviews
    gene named succinate dehydrogenase c sdhc - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id  (ATCC)
    90
    ATCC strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id
    Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC
    Average 90 stars, based on 1 article reviews
    strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    b kit name human calcitonin gene related peptide  (Cusabio)
    93
    Cusabio b kit name human calcitonin gene related peptide
    B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio
    Average 93 stars, based on 1 article reviews
    b kit name human calcitonin gene related peptide - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier
    gene name base pair primer sequence annealing temp  (Wolters Kluwer Health)
    86
    Wolters Kluwer Health gene name base pair primer sequence annealing temp
    Gene Name Base Pair Primer Sequence Annealing Temp, supplied by Wolters Kluwer Health, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene name base pair primer sequence annealing temp/product/Wolters Kluwer Health
    Average 86 stars, based on 1 article reviews
    gene name base pair primer sequence annealing temp - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)  (Oligos Etc)
    90
    Oligos Etc oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)
    Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc
    Average 90 stars, based on 1 article reviews
    oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier

    Image Search Results